Как определить свой гаплотип и гаплогруппу

Содержание
  1. Генетическая генеалогия. Определение гаплогруппы человека
  2. Случаи, в которых применяется генетическая генеалогия и определения гаплогруппы человека
  3. Методика определения гаплогруппы человека
  4. Правовая база для специалистов, осуществляющих определение гаплогруппы человека
  5. Вопросы, которые ставятся перед специалистом по определению гаплогруппы человека
  6. Генетика: Как узнать происхождение генетику и гаплогруппу. Тест на гаплогруппу
  7. Гаплогруппы и гаплотипы: что это такое?
  8. ДНК-тест в десяти разных компаниях на примере моего собственного — Личный опыт на vc.ru
  9. Как происходит сдача биоматериала
  10. Происхождение в тесте MyHeritage
  11. Происхождение в тесте 23andMe
  12. Происхождение в тесте Genotek
  13. Происхождение в тесте «Атласа»
  14. Происхождение в тесте FamilyTreeDNA
  15. Происхождение в GEDmatch
  16. Выводы по происхождению
  17. Здоровье
  18. Здоровье в тесте 23andMe
  19. Здоровье в тесте Genotek
  20. Здоровье в тесте «Атлас»
  21. Здоровье в Genomlink
  22. Здоровье в Promethese
  23. Здоровье в Codegen
  24. Здоровье в Sequencing
  25. Выводы по здоровью
  26. Стоимость тестов
  27. Заключение
  28. ДНК-тесты на происхождение и с чем их едят (часть I)
  29. Анализ на гаплогруппу: как узнать по ДНК тесту на генеалогию
  30. Как узнать свою гаплогруппу
  31. Как проходит анализ ДНК на гаплогруппу

Генетическая генеалогия. Определение гаплогруппы человека

Как определить свой гаплотип и гаплогруппу

В настоящее время появляются новые виды генетических исследований. Одним из последних направлений генетических анализов является генетическая генеалогия или, как ее еще называют, ДНК-генеалогия. Данный вид исследования применяется наряду с традиционными методами генеалогических исследований.

Обычно генеалогия строится на архивных и прочих документальных свидетельствах. В случаях, когда бумажного следа просто нет, либо имеющиеся документы содержат крайне противоречивые сведения, принадлежность к одному генеалогическому древу можно установить посредством исследований ДНК.

К примеру, при исследовании особенностей Y-хромосомы двух мужчин, можно установить, имеют ли два данных человека общего предка по мужской линии.

В основе генетической генеалогии лежит определение гаплогруппы человека, к которой относится человек, генетический материал которого представлен для осуществления экспертизы.

Гаплогруппа – это большая общность людей, которые имеют одного предка. Понятие гаплогруппы базируется на выделении определенного гаплотипа – последовательности аллелей, содержащихся в одном участке (локусе) хромосомы.

Некоторые гены человека (как и любых диплоидных организмов) состоят из двух гаплотипов, один из которых находится в хромосоме, полученной от матери, а второй, соответственно, в хромосоме, полученной от отца.

Начало каждой из ныне существующих гаплогрупп положил предок, у которого в обоих имеющихся гаплотипах присутствовала одна и та же мутация, которая называется однонуклеотидным полиморфизмом. При такой мутации последовательность ДНК в гомологичных участках гомологичных хромосом отличается ровно на один нуклеотид.

Удивительно, но с течением большого количества времени следы данной мутации практически не исчезли и до сих пор прекрасно обнаруживаются при анализе ДНК. Ученые считают, что естественный отбор практически не действует на организмы, имеющие обозначенную мутацию, что и позволяет определять общего предка, полагаясь на исследование принадлежности человека к той или иной гаплогруппе.

Гаплогруппы определяются по Y-хромосоме, по митохондриальной ДНК, а также существуют ГКГ-гаплогруппы, выделяемые согласно главному комплексу гистосовместимости – большой группе генов позвоночных, имеющей большое значение в формировании иммунной системы.

В настоящее время генетическое сообщество разработало общую классификацию и номенклатуру гаплогрупп по Y-хромосоме. Ученые выделили 18 базовых мутационных блоков в хромосоме, которые получили название кладов. Каждый клад обозначается латинской буквой от A до R.

В каждом кладе, соответственно, выделяются гаплогруппы, в названии которых содержится латинская буква, обозначающая данный клад, и дополнительные буквы и цифры. Митохондриальные гаплогруппы  (мт-ДНК гаплогруппы) также были классифицированы.

Каждая группа носит свое название, состоящее из латинских букв и цифр.

Для мужчин возможно проведение исследований по принадлежности к мт-ДНК гаплогруппе или к Y-ДНК гаплогруппе. Для женщин возможно установить принадлежность к гаплогруппе, определяемой путем анализа митохондриальной ДНК.

Следует отметить, что из-за более компактного размера митохондриальной ДНК (по сравнению с ДНК Y-хромосомы) отслеживать дрейф некоторых мутаций с ее помощью несколько сложнее. Считается, что мт-ДНК галогруппы сформировались во время ледникового периода.

Они связаны с этническим происхождением на глобальном, континентальном уровне. Ученые связывают это с более частым покиданием женщинами своего рода – при замужестве.

Все европейские митохондриальные гаплогруппы взяли начало в надгруппе (кладе) N. Считается, что это была одна из двух первых миграционных волн людей из Африки, имевших место 60-80 тысяч лет назад.

Чистая гаплогруппа N на сегодняшний день встречается крайне редко в разных частях Евразии. Распространение гаплогрупп тесно связано с распространением и образованием языков.

Так, например, представители общей славянской гаплогруппы говорят на сходных языках.

Генетическая генеалогия выделяет двух общих предков почти всех людей, живущих в настоящее время. Предки носят практически библейские имена – Y-хромосомный Адам и митохондриальная Ева.

Случаи, в которых применяется генетическая генеалогия и определения гаплогруппы человека

Определение гаплогруппы человека – сравнительно молодой вид генетических исследований, однако с каждый годом его популярность растет, так как он позволяет разобраться во многих запутанных жизненных ситуациях. Чаще всего, к определению гаплогруппы человека прибегают в следующих случаях:

  • Определение национальности. Многие живущие в настоящее время люди хотят знать свои корни, определить свою истинную национальность. Это важно, так как, вследствие множества миграций за последние несколько веков, связь с предками прервалась. Однако, следует помнить, что понятие гаплогруппы гораздо более древнее, чем понятие национальности. И некоторые из существующих групп причудливым образом распределились по разным национальностям, а некоторые – наоборот, сконцентрированы в определенных географических областях, что связано с оседлым образом жизни.
  • Определение родства. Генетическая генеалогия позволяет определить, являются ли два человека дальними родственниками. Чаще всего такие исследования проводятся для однофамильцев, но иногда осуществляются и для людей с разными фамилиями при подозрении на существующее между ними родство.

Методика определения гаплогруппы человека

Для определения гаплогруппы человека в его гаплотипе выделяют определенные метки – маркеры, по которым производится сравнение. Самый распространенный способ определения гаплогруппы человека использует 25-тимаркерные гаплотипы.

Однако за прошедшие несколько тысяч лет произошло множество мелких мутаций в генотипе человека и 25-тимаркерного гаплотипа может оказаться недостаточно. Поэтому стали выделять гаплотипы, содержащие 37, 45, 67, а то и вовсе 111 маркеров.

Чем больше маркеров, тем более точное исследование можно провести, хотя оно будет гораздо более трудоемким и дорогостоящим.

Чтобы провести исследование по определению гаплогруппы человека необходимо собрать его ДНК, что выполняется точно таким же способом, как и для любого другого генетического анализа. Наиболее распространенным является соскоб с внутренней поверхности щеки, производимый специальной ватной палочкой.

После сбора генетического материала, его необходимо передать в лабораторию, осуществляющую процедуру определения гаплогруппы человека. Причем образец ДНК можно даже переслать по почте без ущерба для генетического материала.

Это обстоятельство делает доступными генетические анализы даже для жителей маленьких и отдаленных населенных пунктов.

Необходимая ДНК выделяется из того же буккального эпителия и путем нескольких последовательных секвенирований (выделения нуклеотидной последовательности) определяется необходимый гаплотип.

Правовая база для специалистов, осуществляющих определение гаплогруппы человека

Специалист, проводящий исследования по генетической генеалогии в общем и по  определению гаплогруппы человека в частности, подчиняются  общим требованиям, предъявляемым к лицам, осуществляющим экспертную деятельность.

Статья 307 Уголовного кодекса РФ предписывает наказание за дачу ложных показаний в суде, а также за формулирование заведомо ложных экспертных заключений. Тяжесть данного действия усугубляется определенными последствиями, которое оно повлекло.

Мера наказания увеличивается, если лжесвидетельствование привело к осуждению подследственного лица за совершение тяжкого преступления.

Вопросы, которые ставятся перед специалистом по определению гаплогруппы человека

  • Относятся ли гаплотипы Y-хромосом двух данных мужчин к одной и той же гаплогруппе?
  • Относятся ли двое исследуемых а одной и той же мт-ДНК гаплогруппе?
  • Является ли исследуемый человек представителем определенной гаплогруппы?
  • Из какой местности могли происходить предки исследуемого человека?
  • К какой мт-ДНК гаплогруппе относится исследуемый человек?
  • К какой гаплогруппе, определяемой по Y-хромосоме, принадлежит исследуемый мужчина?
  • Был ли у двух исследуемых мужчин общий предок по мужской линии?

Источник: https://sudexpa.ru/expertises/geneticheskaia-genealogiia-opredelenie-gaplogruppy-cheloveka/

Генетика: Как узнать происхождение генетику и гаплогруппу. Тест на гаплогруппу

Как определить свой гаплотип и гаплогруппу
С помощью меток, оставленных случайными мутациями на Y-хромосоме, вы можете проследить свою родословную по мужской линии вплоть до Адама. Правда, не библейского.Ученые восстановили приблизительную картину расселения народностей по миру до европейской экспансии, начавшейся после 1500 года н.э.

Иногда возможно установить районы расселения с достаточно большой точностью (были проанализированы наборы STR) – это относится к ряду племен американских индейцев и маори.

В других случаях возможны лишь общие предположения относительно принадлежности племен (америнды, семья на-дене или эскимосы)

В ядре каждой человеческой клетки, кроме яйцеклеток и сперматозоидов, содержится диплоидный (двойной) набор из 46 хромосом: 22 пары соматических («телесных») и пара половых: XX у женщин и XY у мужчин.

В половых клетках набор хромосом гаплоидный – одиночный (без греческих терминов тут не обойтись: хромосомная ДНК-генеалогия основана на определении индивидуальных гаплотипов, относящихся к разным гаплогруппам)

Общепринятая классификация линий Y-хромосомы основана на последовательности появления на ней SNP-маркеров. На генеалогическом древе современных мужчин выделено 18 основных ветвей, обозначенных латинскими буквами, от первой ветки у самого корня – А до самой поздней – R.

Эта классификация учитывает примерно 250 маркеров, по которым сейчас выделяют около 170 конечных «веток», каждая – со своим набором последовательно происходивших мутаций. По мере выявления новых маркеров к схеме добавляются новые ветви.

Каждая из современных ветвей молекулярно-генеалогического древа отличается от Адама примерно двумя десятками разных мутаций в разных участках Y-хромосомыВопрос «откуда есть пошла?..» для целых племен и народов до недавнего времени решался с помощью данных истории, археологии, лингвистики и других не очень точных наук.

Определить свою личную родословную любой человек мог с помощью архивов ЗАГСов, ревизских сказок, церковноприходских книг – на три, пять, хорошо если на 10–15 поколений.Сейчас любой из нас может определить свою родословную до прародителей человечества.

Правда, не библейских, а молекулярно-генетических – «митохондриальной Евы» и «Y-хромосомного Адама». К ним, жившим в Юго-Восточной Африке (по самым общепринятым из условных и приблизительных оценок – 150–170 или 60–80 тысяч лет назад), сходятся ветви генеалогического древа каждого из живущих на Земле 6,6 млрд человек.

За прошедшие века в нашей ДНК, как визы в паспорте, добавились пометки о путях, по которым потомки Адама разбрелись по миру.

Какой народ каким путем добрался до нынешнего места жительства за тысячелетия великих и незаметных переселений, завоеваний, объединений и смешений? Как носило по свету лично ваших предков с тех пор, как они покинули колыбель народов – Африку? И от какой из групп этих переселенцев вы происходите – отдельно по отцовской и материнской линии? Сколько поколений назад жил ближайший предок, от которого по прямой линии произошли лично вы и кто-нибудь из ныне царствующих особ? На все эти вопросы может ответить анализ ДНК.

Изучать этногеномику начали в 1980-х годах, когда компьютеры еще не обладали таким быстродействием, а методы анализа ДНК были на несколько порядков медленнее и дороже нынешних.

Сейчас самый простой, но достаточно полный анализ индивидуальной молекулярной генеалогии, по 12 маркерам Y-хромосомы, стоит $100–150, а более чем достаточный, по 37 маркерам Y-ДНК + полный тест митохондриальной ДНК, – около $400.

Базы данных на десятки тысяч образцов ДНК есть у ряда коммерческих фирм и общественных институтов, и большинство из них (с определенными ограничениями на допуск к персональной информации) открыты для всех. За счет интереса людей к своим индивидуальным родословным информация в этих базах накапливается быстрее, чем ученые успевают ее обработать.

Самое грандиозное из исследований целых популяций – Genographic Project («Генографический проект»), начатый в 2005 году Национальным географическим обществом США (National Geographic Society) при поддержке компании IBM.

Цель проекта – за пять лет собрать не менее 100 000 образцов ДНК типичных представителей народов или племен, история которых известна по данным этнографии, истории и археологии, чтобы уточнить пути миграций человечества по Земле.

На самом деле и такая огромная выборка – капля в море по сравнению с реальным разнообразием рас и племен, но по мере добавления информации результаты можно будет уточнять. Даже черновой план, составленный участниками проекта под руководством доктора Спенсера Уэллса, – захватывающее зрелище, особенно в виде интерактивной карты на сайте проекта. Но для начала разберемся с терминами.

При образовании половых клеток из диплоидных клеток-предшественников их соматические хромосомы (а у женщин – и половые) обмениваются участками – примерно так, как происходит, если не слишком тщательно перетасовать две колоды карт с рубашками разного цвета и снова разложить их на два одинаковых набора независимо от цвета рубашек.

По четверти генома мы получаем от каждого из двух дедушек и двух бабушек, 1/8 – от прадедов и прабабок…

В наших хромосомах есть гены не только Адама и Евы, но и всех их близких и дальних родственников, живших 70–80 тысяч лет назад, когда численность нашего вида снизилась до критической величины – примерно 10 000 особей, и более далеких предков, вплоть до первых млекопитающих и даже первых многоклеточных животных.

Но от них мы получили только соматические и X-хромосомы, гены которых в результате постоянного перемешивания расплываются по всей популяции. Почти неизменными из поколения в поколение переходят только Y-хромосома и митохондриальная ДНК. На этом «почти» и основана вся молекулярная генеалогия, изучающая историю по мутациям, произошедшим у предков и сохранившимся в ДНК потомков.

Обычно крупные мутации – например, перемещение на другое место, удвоение или, наоборот, выпадение крупного участка хромосомы, несущего один или несколько генов, – не приводят ни к чему хорошему. Как, впрочем, и часто встречающиеся одиночные нуклеотидные полиморфизмы – SNP (см. врезку), если они происходят в пределах одного из 21 000 человеческих генов.

Полезные мутации происходят намного реже и сохраняются в последующих поколениях. Вредные – удаляются из популяции вместе с носителем или еще на стадии эмбриона, или, при тяжелой наследственной болезни, до того, как этот носитель успеет обзавестись потомством.

В результате действия стабилизирующего отбора и происходивших время от времени снижений численности вида, уменьшающих его генетическое разнообразие, строение генов у двух выбранных наугад людей совпадает на 99,9%.

Все наши отличия, от цвета кожи и разреза глаз до роста и склонности к определенным болезням, определяют в основном генные полиморфизмы – незначительные различия в нуклеотидных последовательностях практически одинаковых генов и, соответственно, в строении и функциях закодированных в этих генах белков.

Во-первых, случайные мутации происходят постоянно, и полиморфизмами считают те из них, которые произошли давно и поэтому встречаются чаще, чем у 1% людей в данной популяции (граница здесь условная – можно было бы считать случайными и варианты генов, встречающиеся реже, чем у 2–3%).

Во-вторых, полиморфизмы не оказывают заметного влияния на здоровье их носителей или даже носят приспособительный характер. Правда, и здесь граница довольно размытая. Классический пример – SNP, обусловливающий у гомозигот – носителей двух мутантных генов – тяжелое наследственное заболевание, серповидноклеточную анемию.

Но гетерозиготы по этому гену – носители здорового варианта на одной хромосоме и «испорченного» на другой – реже болеют малярией, а симптомы анемии испытывают только в экстремальных условиях, например в высокогорье. Эта мутация встречается на юге Индии, в Средиземноморье и у жителей Западной Африки и их потомков на других континентах.

При копировании хромосом «снипы» происходят с вероятностью 10–8 на один нуклеотид за поколение. При размере гаплоидного генома в 3 млрд (3х109) нуклеотидов за счет случайных точечных мутаций каждый ребенок имеет в среднем около 30 однонуклеотидных различий со своими родителями.

По счастью, большинство таких мутаций приходится не на гены, а на так называемую мусорную ДНК – примерно 95% человеческого генома, не кодирующих ни белков, ни служебных РНК. Эти мутации ни на что не влияют, отбору они безразличны – вот они и сохраняются среди остального генетического «хлама». Именно их, а также короткие тандемные повторы (см.

врезку), и используют в молекулярной генеалогии в качестве хромосомных маркеров – характерных особенностей.Начнем с Адама: с мужской молекулярной генеалогией разобраться проще (впрочем, все сказанное ниже о своем происхождении по мужской линии могут узнать и дамы – для этого нужно проанализировать ДНК отца, или брата, или дяди – любого прямого родственника по отцу).

Примерно 300 млн лет назад у первых млекопитающих одна из хромосом, несущая среди прочих несколько генов, определяющих принадлежность к мужскому полу, начала терять остальные гены и вместе с ними – способность обмениваться участками ДНК с парной хромосомой. У человека на Y-хромосоме осталось всего 27 генов, большинство из них работают в семенниках. Остальная часть Y-хромосомной ДНК может пригодиться разве что для этнографии и генеалогии. Мутации – выпадения, замены или добавления одиночных нуклеотидов (SNP) и изменения числа повторений трех-четырех одинаковых нуклеотидов (STR) – происходят в разных участках Y-хромосомы с разной частотой, в среднем – одна мутация на каждые 500 поколений. В самых консервативных участках мутации случаются раз в 100 000 лет.Y-хромосомный Адам жил примерно 80 000 лет назад, но «раз в 100 000 лет» – это вероятность мутации в этом участке хромосомы в непрерывном ряду поколений, и можно подсчитать, что даже такой редкий случай может произойти один раз в поколение примерно у одной из 3000 пар «отец–сын». Время и место жизни нашего общего прямого предка вычислили по анализу распределения в популяциях из разных регионов планеты Y-хромосомных маркеров. Их используют и для исследований в области этногеномики, и для выяснения индивидуальных генеалогий.

У населения старинных русских городов чаще всего встречаются гаплогруппы R1a1, I2a и N1c1. Очень условно их носителей можно назвать соответственно потомками восточных, южных и северных славян. На самом деле мутация, определяющая принадлежность к ветви R, предположительно появилась на северо-западе Азии 30–35 тысяч лет назад: в племени, все мужчины которого (или большинство из них) относились к более ранней гаплогруппе P, родился мальчик, в Y-хромосоме которого произошел сбой – замена всего одного нуклеотида, аденина на гуанин. Его потомки расселились по Европе и западной части Азии, по дороге смешиваясь с местными племенами, но у всех его прямых наследников сохранилась эта метка – маркер M207. Ее нашли и у мужчин одного из изолированных племен Камеруна – скорее всего, это потомки части доисторического племени, которая вернулась из Евразии в Африку.

У кого-то из пра-пра…правнуков родоначальника гаплогруппы R, двигавшихся понемногу на юг, 25 000 лет назад произошла еще одна мутация, M127. Ее носители, представители гаплогруппы R2, составляют 5–10% населения юга Центральной Азии, Пакистана и северной Индии. Еще одна ветвь этой группы повернула на запад, на земли, с которых сползал последний ледник.

Подгруппа R1, у которой к предыдущим меткам на Y-хромосоме приблизительно 30 000 лет назад добавилась мутация M173, – самая распространенная в Европе и западной Евразии.Этногеномика имеет дело с вероятностями мутаций, полученными путем приблизительных подсчетов, выборками из популяций и другими среднестатистическими величинами.

Даже число тысячелетий в расчетах зависит от того, какое время смены поколений, от 20 до 35 лет, выберут авторы работы. Максимальное приближение во времени, которое показывает гаплогруппа даже с самым длинным буквенно-цифровым индексом, – это вероятность появления одного SNP, в лучшем случае 5000 лет, так что деталей индивидуальной генеалогии по ней не определить.

Можно разве что спорить, родственниками в двухсотом или трехсотом колене приходятся друг другу больше трети жителей северной Индии, почти половина русских и почти треть норвежцев.А можно ли построить генеалогическое древо человека с более высокой точностью? Можно, но SNP для этого не подходят. Для детальных исследований в молекулярной генеалогии применяют короткие тандемные повторы – STR (см.

врезку). При образовании сперматозоидов ферменты, копирующие ДНК клетки-предшественника, иногда пропускают или добавляют к такому тандему один из повторов. Если этот сперматозоид примет участие в рождении мальчика, все его сыновья, внуки и правнуки сохранят новую запись в этом маркере до тех пор, пока прямой род по мужской линии не оборвется – или до следующей мутации в том же STR.

Повторная мутация может увеличить разницу в большую или меньшую сторону, сделав различия между ветвями древа более четкими, а может и восстановить исходное состояние. Но при использовании большого числа маркеров степень родства можно установить достаточно точно.

У всех мужчин на Земле в локусах DYS19, 388, 390, 391, 392 и 393 есть тандемные повторы разной длины.

Например, квадруплет TAGA (DYS19) может повторяться от 10 до 19 раз, триплет АТА (DYS388) – 10–16 раз и т.д. У 98% мужчин к базовому набору из шести общих маркеров, унаследованных от хромосомного Адама, добавился DYS385 – от 7 до 28 повторов «GAAA». У 34% есть еще DYS438 и 439 и т.д.

В качестве генеалогических маркеров выбраны самые информативные из почти пятисот обнаруженных на Y-хромосоме STR. Стандартные ДНК-генеалогические тесты проводят по 12, 25, 37 или 67 маркерам, хотя уже шести часто достаточно для того, чтобы по комбинации числа повторов отнести «владельца» этого гаплотипа (индивидуального набора маркеров) к одной из гаплогрупп, от A до R.

Например, так называемый «атлантический модальный гаплотип», наиболее распространенный на западе Европы, выглядит так: DYS19=14, DYS388=12, DYS390=24, DYS39=11, DYS392=13, DYS393=13. Человек с таким гаплотипом практически со стопроцентной вероятностью относится к гаплогруппе R1b или ее подвариантам.

Чем меньше расхождений в числе повторов нуклеотидных групп во всех проанализированных DYSах между двумя гаплотипами, тем больше вероятность того, что их носители – родственники. В тесте по 37 маркерам вероятность случайного совпадения всех из них – 1/637, 1 шанс из 6х1028 (население Земли, напомним, 6,6х109). Даже по 12 маркерам вероятность случайного совпадения – 1 шанс из двух с лишним миллиардов, и при полном совпадении чьих-нибудь DYS с вашим гаплотипом (и совпадении гаплогруппы) можно быть уверенным, что вы нашли брата, отца, дядю или «многоюродного» (но не более чем в десятом – пятнадцатом колене) родственника по прямой мужской линии. А что может быть в случае, если в такой базе вы найдете последовательность чисел, отличающуюся от вашей на 1, 2 или 5 единиц? Можно прикинуть, сколько поколений назад жил ваш ближайший общий предок. Расхождение на один повтор в любом из маркеров происходит в среднем один раз в 500 поколений, примерно раз в 15 000 лет. В гаплотипе из 37 маркеров одна мутация может произойти примерно раз в 13 поколений, или в 300–400 лет. Хотя средние частоты мутаций в различных DYS отличаются, они известны, так что можно еще немного уточнить возможное время расхождения. Правда, все равно это будет всего лишь вероятность, но дальше уже можно будет покопаться в бумажных данных, от семейных архивов до летописей. И в любом случае вы узнаете много интересного, особенно если к информации об Y-хромосоме добавить анализ митохондриальной ДНК. Но о родстве по материнской линии читайте в дальнейших постах.

Источник: http://haplogroup.narod.ru/info.html

Гаплогруппы и гаплотипы: что это такое?

Как определить свой гаплотип и гаплогруппу

Вопрос, который нередко задают – а зачем это вообще знать? Ну, жил бы человек, не зная, что у него гаплогруппа Н, или N, или I, или R, и такой-то гаплотип, и продолжал бы жить так же. А уж делать ДНК-тесты трижды подряд, продвигаясь каждый раз на ступеньку глубже – зачем все это? Тем более за свои деньги?

Мне такие вопросы задавали многие. Опыт разговоров или переписки с такими людьми показал, что эти вопросы и комментарии бывают или наигранными, порой от непонимания, или, напротив, убежденными. Последние обычно быстро приходят к тому (или начинают с того), что изучение истории вообще не нужно. Глупости всё это.

По мнению таких «убежденных», знание истории вообще и своей персональной истории, истории своих предков, никак не сказывается на материальном благосостоянии современников, напротив, тратить на это время совершенно контрпродуктивно.

Некоторые подводят под это «научную» базу, что наши гены быстро «размываются» в поколениях, и всего через десяток поколений все становятся одинаковыми, усредненными, и зачем при этом что-то изучать из прошлого?

Результаты ДНК-тестирования мужчин в рамках ДНК-генеалогии сводятся к двум основным показателям. Это – гаплотип и гаплогруппа. Гаплотип – это набор чисел, который является «личным номером ДНК-паспорта» любого мужчины, без исключения.

А гаплогруппа, фигурально говоря, это обложка паспорта. Это – не индивидуальная, а групповая характеристика. Гаплогруппа определяет носителя гаплотипа в определенный род, или историческое племя.

У любой гаплогруппы, как у любого рода или племени, был один общий предок, патриарх.

Поэтому как номер паспорта при наличии обложки является уникальным «определителем» человека, так и гаплотип в совокупности с гаплогруппой являются не менее уникальным определителем человека, при условии, что номер (гаплотип) является достаточно протяженным. Примеры даны ниже в этой книге.

Если у человека такого номера и паспорта нет, то это не мужчина, а женщина. Именно к такому выводу сейчас нередко приходят археологи, которые именно так наиболее надежно определяют пол скелетного остатка в древнем захоронении.

Нет в ДНК Y-хромосомы, нет мужского гаплотипа и мужской гаплогруппы – значит, женщина. У последних – свой ДНК-паспорт, под названием «митохондриальная ДНК», который они передают своим детям, как девочкам, так и мальчикам.

А отец передает исключительно Y-хромосому, и только, разумеется, сыновьям.

Мало того, что эта «научная база» категорически неверна, но мой опыт показывает, что с последними «дискутантами» дискуссии бесполезны, и через одну-две фразы из подобного рода «убеждений» разговор надо заканчивать. Там ситуация безнадежна, это уже глубинный уровень их мировоззрения. Я не говорю, что мировоззрение у них неправильное, вовсе нет. Оно просто другое, и обсуждать его бесполезно, как и спорить с его носителем.

Напротив, огромное количество людей хотят изучать историю мира, народа, рода, свою родословную. Когда-то я имел отношение к проведению опроса людей, которые прошли тест на ДНК, и узнали свои гаплотип и гаплогруппу.

Основной вопрос был такой – изменило ли это вашу жизнь? Из многих десятков людей ни один не ответил, что остался безразличным к результатам тестирования. Все ответили, что в определенной степени (иногда в большой) это их жизнь изменило.

Большинство продолжили анализ своей ДНК на более глубоком уровне, и расширили изучение истории мира, своего народа, своей родословной.

У каждого мужчины в Y-хромосоме своя картина мутаций. У близких родственников картина мутаций похожа, потому что они, родственники, сравнительно недавно произошли от одного общего предка, и дополнительные мутации в их Y-хромосомах еще не успели образоваться. Если общий предок жил тысячелетия назад, то картина мутаций у разных потомков разная. Как эту картину отображают?

Отображают картину мутаций в виде так называемых гаплотипов, упомянутых выше как «личный номер паспорта» каждого мужчины, а именно в виде определенных последовательностей чисел, характерных для каждого человека. Чем эта последовательность длиннее, тем уникальнее гаплотип. Например, у автора этих строк гаплотип Y-хромосомы, состоящий из 111 чисел, записывается в следующем виде:

13 24 16 11 11 15 12 12 10 13 11 17 – 16 9 10 11 11 24 14 20 34 15 15 16 16 – 11 11 19 23 15

16 17 21 36 41 12 11 – 11 9 17 17 8 11 10 8 10 10 12 22 22 15 10 12 12 13 8 15 23 21 12 13

11 13 11 11 12 13 – 31 15 9 15 12 25 27 19 12 12 12 12 10 9 12 11 10 11 12 30 12 14 25 13

9 10 18 15 20 12 24 15 12 15 24 12 23 19 11 15 17 9 11 11

Это — так называемый 111-маркерный гаплотип.

Здесь первое число показывает, что в одном из маркеров, или локусов Y-хромосомы определенная последовательность нуклеотидов (в данном случае квадруплет AGAT, то есть аденин–гуанин–аденин–тимин повторяется 13 раз).

В другом маркере, который здесь показан как следующий, блок нуклеотидов (TCTG, то есть тимин–цитозин–тимин–гуанин) повторяется 24 раза, и так далее. У каждого маркера – своя комбинация нуклеотидов.

В академических публикациях по популяционной генетике, впрочем, пока продолжают использовать гаплотипы от 8- до 17-маркерных. В ДНК-генеалогии обычным является использование 67- и 111-маркерных гаплотипов.

В итоге многолетних наблюдений я пришел к выводу, что изучение своей родословной, особенно с привлечением ДНК-генеалогии, безусловно, влияет на наш современный уровень жизни, благосостояние, самооценку, достоинство.

Более того, знание и ощущение своего прошлого и прошлого страны, прошлого своего народа каким-то удивительным образом связано с личным миропониманием и мироощущением, и через него – с уровнем личного достоинства и уровнем жизни семьи и всего сообщества.

Откуда получают те числа, которые показаны в гаплотипах? Всё это на самом деле четко определено и зафиксировано. В первом маркере (под названием DYS393) повторяется четверка нуклеотидов AGAT, то есть аденин-гуанин-аденин-тимин

GTGGTCTTCTACTTGTGTCAATAC/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/ATGTATGTCTTTTCTATGAGACATACCTCATTTTTTGGACTTGAGTTC,

и повторы обрамляются уже неупорядоченными последовательностями нуклеотидов в ДНК, как показано выше. Этот участок в ДНК и есть локус, он же маркер DYS393. Во втором маркере, под названием DYS390, повторяется уже другая четверка – TCTG, то есть тимин-цитозин-тимин-гуанин, которая переходит в четверку TCTA, то есть тимин-цитозин-тимин-аденин, и число повторов складывается:

TATATTTTACACATTTTTGGGCCCTGCATTTTGGTACCCCATAATATATTCTATCTA/TCTG/TCTG/TCTG/TCTG/TCTG/TCTG/TCTG/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTG/TCTA/TCTA/TCTA/TCATCTATCTATCTTTCCTTGTTTCTGAGTATACACATTGCAATGTTTTCATTTTACTGTCAC.

Перечисленные четыре нуклеотида — это язык ДНК, который состоит из четырех букв при сокращенной записи. Эти нуклеотиды комбинируются парами, их так и называют — «пары оснований». Они фактически держат двойную спираль ДНК.

Нам эти четверки (а также тройки нуклеотидов, и другие типы повторов) в маркерах ДНК в дальнейшем не понадобятся, это описание мы даем только для того, чтобы показать, что за числами в гаплотипах стоят масштабные исследования, которыми занимаются в мире сотни и тысячи человек.

Приведу свой личный пример. Полтора десятка лет назад я довольно случайно узнал о возможности определить свои гаплогрупп и гаплогруппу.

Причем узнал от весьма малоаппетитной личности, с которым имел немало коллизий в сетевых дискуссиях, узнал, когда тот похвалялся, что анализ ДНК показал, что он – «чистый русский». Меня заинтересовало, как ДНК это может показать, и что такое «чистый русский».

Как и оказалось, та похвальба была, как обычно у него, пустой. Никакой гаплотип или гаплогруппа не показывают, что некто есть «чистый русский», «чистый украинец», или «чистый еврей». Это вообще «перпендикулярные» понятия, так сказать.

Но гаплотип и гаплогруппа показывают род, показывают (в совокупности с другими гаплотипами или гаплогруппами), откуда род ведет свои корни, когда и где (при наличии дополнительных исследований) жили предки рода, пути и времена древних миграций, связь с древними археологическими культурами.

Естественно, чем протяженнее гаплотип, тем выше вероятность того, что в нем произойдет мутация. Мутация в гаплотипах – это результат ошибки в копировании блоков нуклеотидов, тех самых «коротких тандемных повторов», биологической системой копирования ДНК в клетке.

Каждый нуклеотид мутирует, то есть копирующая система ошибается при копировании протяженных гаплотипов, со средней вероятностью примерно 0.00178 раз в поколение при протяженности поколения 25 лет, то есть раз в 560 поколений, то есть раз в 14 тысяч лет.

Величина поколения в 25 лет в ДНК-генеалогии называется условным поколением, она – сугубо математическая величина. Если кому-то больше нравится брать 30 лет за поколение, то вероятность мутации за 30 лет составит примерно 0.

00214, или раз в 468 поколений (по 30 лет), или раз в 14 тысяч лет. Как видим, конечный результат получается точно такой же.

Итак, у любого человека можно выявлять гаплотип с разным разрешением, это будет один и тот же «ДНК-генеалогический паспорт», только разрешение, естественно, тем больше, чем более протяженный гаплотип. Надо сказать, что наука не остановилась на 111-маркерном гаплотипе, и, например, у того же автора определен уже 431-маркерный гаплотип:

13 24 16 11 11 15 12 12 10 13 11 30 16 9 10 11 11 24 14 20 34 15 15 16 16 11 11 19 23 15 16 17 21 36 41 12 11 11 9 17 17 8 11 10 8 10 10 12 22 22 15 10 12 12 13 8 15 23 21 12 13 11 13 11 11 12 13 — 31 15 9 15 12 25 27 19 12 12 12 12 10 9 12 11 10 11 12 30 12 14 25 13 9 10 18 15 20 12 24 15 12 15 24 12 23 19 11 15 17 9 11 11 — 10 12 15 15 10 10 8 8 9 13 7 8 10 10 13 14 14 15 31 32 11 10 9 9 8 24 8 8 8 16 22 22 24 21 23 14 16 25 28 15 15 6 11 14 15 8 14 11 12 10 11 10 10 11 11 18 10 12 10 7 10 5 8 9 5 5 11 15 8 29 6 7 10 13 11 6 7 7 7 16 10 11 16 22 23 11 12 12 10 7 12 12 13 7 3 20 18 11 11 8 9 13 13 10 11 22 12 16 13 14 11 11 12 10 12 9 13 9 12 11 12 16 7 14 12 10 9 10 4 7 7 13 13 12 11 9 11 10 11 14 8 4 8 6 11 11 16 9 11 13 19 12 12 9 10 9 9 11 11 9 9 14 14 15 9 7 10 12 14 13 14 14 12 6 32 10 11 16 8 7 17 17 11 11 6 13 12 13 11 10 7 13 12 7 – 12 12 7 14 17 17 11 25 8 8 12 8 8 1113 11 12 10 8 13 8 13 14 10 11 9 20 17 15 36 9 13 14 39 33 36 9 10 10 12 18 19 13 9 14 44 10 8 14 9 8 20 11 11 11 11 10 9 9 9 8 8 8 8 9 11 9 23 11 9 16 31 8 20 8 13 12 8 16 10 9 33 27 23 22 10 8 12 10 8 14 8 8 32 55 7 7 5 9 6 11 11 11 13 9 39 33 7 8 27 7 5 13 7 15 28 25 60 42 12 31 22 20 12 3 4

Таких гаплотипов в мире определено пока всего несколько десятков, так что практическая польза от них пока невелика, за исключением нескольких специальных случаев, которые будут пояснены ниже.

Поскольку «коротких тандемных повторов» в Y-хросомоме многие тысячи (выше показано 431 таких повторов, и это только среди 10 миллионов нуклеотидов Y-хромосомы, этот размер определяется методологией исследования; всего же в Y-хромосоме примерно 58 миллионов нуклеотидов, или, точнее, нуклеотидных пар, но не будем здесь вдаваться в излишние подробности). Отсюда можно заключить, что таких «тандемных повторов» в Y-хромосоме может быть примерно 2500, и это, видимо, максимально возможный размер гаплотипа.

Как читатель видит, я не делаю из своего гаплотипа (см. врезку) какой-то секрет, и другим не советую. В нашем мире глобальной информации, где о каждом из нас в сети имеется масса сведений, значительно более потенциально вредоносных, раскрытие гаплотипа вообще никакой опасности не представляет.

Гены не имеют к нему никакого отношения, никаких сведений о здоровье или медицинской диагностики там нет, именно потому, что там нет генов. Байки о том, что якобы на гаплотип можно нацелить некое биологическое оружие, не только безосновательны, но и глупы.

Такое «биологическое оружие» нацеленное, например, на гаплотип группы R1a, которая есть у половины русских, положило бы почти половину литовцев и латышей, половину украинцев и поляков, треть немцев и шведов с норвежцами, и не менее 20% жителей США и Канады.

Поэтому уже сотни тысяч человек, в основном из стран Запада, заносят свои гаплотипы в общедоступные базы данных, и никаких опасений по этому поводу не испытывают.

Гаплотипы выбирают так, чтобы в них маркеров было как можно больше (но все-таки чтобы оставаться в рамках практичности), и в ранних академических работах использовались 6-маркерные гаплотипы, затем 12-маркерные, 17- и 19-маркерные, затем 25- и 37-маркерные, а сейчас работа рутинно ведется с 67- и 111-маркерными гаплотипами (правда, в академических публикациях это обычно от 8 до 17 маркерных гаплотипов). В 111-маркерных гаплотипах одна мутация происходит в среднем за 5 поколений, поэтому у 111-маркерных гаплотипов разрешение лучше других. Но их определять дороже, чем более короткие, поэтому в академических исследованиях, при постоянной нехватке денежных средств, приходится работать с более короткими гаплотипами. Протяженные гаплотипы определяют в коммерческих компаниях, обычно персонально, по индивидуальному заказу, и передают в общественные базы данных, если носитель гаплотипа не возражает. Правда, у возражений практически никогда нет оснований, это всегда «нутряное» «как бы чего не вышло». Сейчас в общественных базах данных — сотни тысяч гаплотипов, и базы прирастают многими гаплотипами ежедневно.

Как мы покажем ниже, эти гаплотипы, а именно числа в них, напрямую связаны с хронологией древних миграций людей, переходами людей на новые места, событиями прошлого — войнами, климатическими катаклизмами, эпидемиями, в общем, со всем тем, что так или иначе влияло на численность популяций человека в определенные времена и на определенных территориях. Например, расчеты могут показать когда носители гаплогруппы N были на Урале, когда они появились в Прибалтике, когда древние арии появились на Русской равнине, когда они появились в Индии, Иране, на Ближнем Востоке — потому что эти события приводили к появлению на этих территориях и в те времена общих предков популяций, потомки которых увеличивались в числе вплоть до нашего времени, образуя «кусты» гаплотипов со всеми мутациями в них, то есть изменениями чисел в маркерах.

Обратимся к гаплогруппам, тем самым «обложкам паспорта», групповым характеристикам.

Большое число мутаций и, соответственно, большое временное расстояние между гаплотипами разных гаплогрупп (десятки тысячелетий) вызвано тем, что они относятся к разным родам человека, а относительно умеренное расстояние между двумя гаплотипами одной гаплогруппы (и к тому же одного субклада), часто всего несколько тысяч лет, и вызвано тем, что они фактически родственники, в рамках понятий ДНК-генеалогии. В целом понятия гаплогруппы и субклада часто взаимозаменяемы, и определяются контекстом изложения. И гаплогруппы, и субклады определяются необратимыми мутациями в Y-хромосоме, в отличие от обратимых мутаций в гаплотипах (тех самых повторов, что описаны выше, которые в научной литературе называют STR, от Short Tandem Repeats). Эти необратимые мутации, которые называют снип-мутациями (от сокращения SNP, Single Nucleotide Polymorphism), стараются подобрать такие (для идентификации гаплогрупп и субкладов), которые были бы стабильными за все время существования человечества. Поэтому гаплогруппы и субклады стабильны, не меняются во времени.

Я заказал определение своих гаплотипа и гаплогруппы в соответствующей компании, и вскоре получил ответ. Ответ меня заинтриговал, и я отправился в архивы, военные и региональные, искать своих предков. Пошла обильная информация, о которой я не имел ранее никакого понятия.

Оказалось, что мои прямые предки из детей боярских, древнего военно-боевого дворянского сословия, что десятки моих прямых и близких родственников охраняли границы Руси, что мой предок ходил с Петром Первым брать Азов, и оттуда участвовал в Казикерменском походе, о котором я ничего не знал, а сейчас знаю много, и оказалось, что у нас в Курской области есть фамильная деревня, земля для которой была выделена моему прямому предку Ивану Клёсову в 1639 году царским указом за боевую службу.

Я отправился в ту деревню Клёсово, взял у жителей той деревни образцы ДНК, отправил на анализ, и увидел, что это на самом деле мои гаплотип и гаплогруппа, и всего несколько мутаций в гаплотипах показали, что наш общий предок жил в конце 16-го века, о чем и рассказали до того архивы.

Дальнейшие исследования, еще более глубокие, показали, что мой гаплотип и субклад, точнее, мои прямые предки, которые его имели – выходцы из восточно­карпатской ветви гаплогруппы R1a, общий предок которой жил в I тыс до н.э., во времена зарождения славянства в том виде, в каком его понимают историки.

Но анализ моей Y-хромосомы прошел дальше – мои предки жили в археологической фатьяновской культуре, которая располагалась в центральном европейском регионе современной Российской Федерации примерно 4500-3500 лет назад, и вполне может быть названа древнерусской археологической культурой.

В свою очередь ее предки – археологическая культура боевых топоров, начиная примерно с 5200 лет назад. Ископаемые ДНК последней, с археологической датировкой 4600 лет назад – имеют гаплотип, практически такой же, какой у меня.

Мои корни, как и корни любого мужчины на планете, описаны в этой книге, в ее разных главах, только я могу примерить всю эту информацию на себя, а те, кто не знают своих гаплотипа-гаплогруппы, не могут. В этом – большая разница в мироощущении между нами.

Я не знаю, какой в итоге будет сформулирована русская (или российская) национальная идея, но то, что она не может быть адекватно сформулирована без учета и без знания истории наших предков, это совершенно определенно. А без знания своих предков патриотизм – просто пустое слово. У него тогда нет основы.

То, что хлёстко называют «последним прибежищем негодяя» – это и есть патриотизм без основы. Только эта хлёсткость не про патриотизм, она – про негодяя. Характерная особенность русофобов в том, что они не там в этой фразе ударение ставят. Надо на негодяе, а они – на патриотизме. Впрочем, на то они и русофобы.

Мутации в гаплотипах потомков расходятся от предкового гаплотипа как круги по воде, число мутаций легко рассчитывается, и они подчиняются довольно простым количественным закономерностям.

Для кругов на воде, расходящихся от места, куда был брошен камень, легко рассчитать, когда был брошен камень, если знать скорость распространения волны и место нахождения круговой волны в данный момент времени. Чем больше прошло времени – тем дальше круги ушли, тем больше они разошлись.

Так и в гаплотипах – чем больше время, прошедшее от общего предка, тем больше мутаций накопилось в гаплотипах его потомков.

Число этих мутаций связано с временем, прошедшим от общего предка, с числом гаплотипов в серии, и с константой скорости мутации в гаплотипах, и выражается простой формулой: n/N = kt, где n – число мутаций в серии из N гаплотипов, k – константа скорости мутации (в числе мутаций на гаплотип за условное поколение, равное 25 лет), t – число условных поколений, с табличной поправкой на возвратные мутации.

На многих тысячах примеров показано, что эта формула работает при любом числе гаплотипов и мутаций в них, и при любом времени, прошедшем от общего предка рассматриваемых гаплотипов.

Однако при очень больших временах, более 10-20 тысяч лет, и особенно более 100 тысяч лет, нужно использовать гаплотипы с «медленными» маркерами, то есть с малыми константами скоростей мутаций, и тем самым снижать число мутаций и число возвратных мутаций.

По аналогии, вряд ли целесообразно изучать скорости радиоактивного распада элементов со временами полураспада в тысячелетия, используя секундомер. Или пытаться изучать круги на воде за километры от места, куда был брошен камень, для этого нужно значительно более мощное воздействие.

Как всегда, нужен конкретный анализ в конкретной ситуации, единых подходов на все случае жизни не бывает. Варианты конкретного анализа в конкретных ситуациях и рассматривает ДНК-генеалогия.

Мутации в ДНК-генеалогии – это не только единичные необратимые мутации-снипы, описанные выше, которые определяют гаплогруппы и субклады, но и обратимые мутации, меняющие числа повторов, или аллели, в гаплотипах.

В русскоязычной литературе их называют просто «мутации», с пониманием, что это не те мутации (в генах), которые обычно возникают под действием радиации. Переход числа повторов в маркере Y-хромосомы от 25 к 24 или 26 (или наоборот) имеет совершенно другую природу, чем «поломка» гена.

Такой переход является следствием спонтанной, случайной ошибки ДНК-копирующей «биологической машины», это процесс первого порядка с точки зрения физико-химической или биологической кинетики, он не зависит от внешних воздействий.

Что важно отметить – в большинстве случаев результаты расчетов почти не зависят от размера выборки (при числе гаплотипов больше двух-трех десятков), то есть они достаточно устойчивы к статистическим вариациям. Размер выборки увеличивает точность, и то только до определенных пределов. Это относится к довольно большим популяциям, которые перемешались за тысячелетия, но именно с такими обычно и работают.

А.А. Клёсов

Источник: https://zen.yandex.ru/media/id/5a8b32de3c50f7f27676c0e5/5b023a549d5cb301fe5cbe58

ДНК-тест в десяти разных компаниях на примере моего собственного — Личный опыт на vc.ru

Как определить свой гаплотип и гаплогруппу

Как я сделал анализ и расшифровку ДНК в «Атласе», Genotek, 23andMe, MyHeritage и ещё в шести сервисах — и что из этого вышло.

Нет, у меня не было задачи делать такое сравнение. Изначально я, заинтересовавшись своим происхождением и заполняя генеалогическое древо на MyHeritage, много раз видел баннер с предложением купить тест ДНК. Несколько недель он мне мозолил глаза, и в какой-то момент я все же клюнул на распродажу и заказал тесты себе и семье.

Пока мне почтой из США шли тесты, я начал изучать сайты и форумы с целью понять, что за зверь такой — ДНК-тесты. Оттуда я понял, что заказанный мной тест в MyHeritage не самый удачный, так как предполагал только неполные данные о происхождении и в нем отсутствовала интерпретация данных о здоровье. А почитав примеры, я понял, что тоже хочу знать больше о своем здоровье.

Ну а там опять начались распродажи. И докупил еще тестов в других лабораториях, даже не дождавшись результатов первого.

Хотя я также покупал тесты жене, детям и другим родственникам в разных лабораториях, сравнивать буду на примере своего.

Я перебрал все самые популярные в России и мире тесты. Глобально можно выделить два направления: происхождение и здоровье. В каких-то сервисах есть только происхождение, в каких-то только здоровье, некоторые содержат и то, и то.

Итого биоматериал я сдал в четырех лабораториях:

  1. MyHeritage.
  2. 23andMe.
  3. Genotek.
  4. «Атлас».

Взяв сырые данные, я расшифровывал и интерпретировал их в еще шести сервисах:

  1. FamilyTreeDNA.
  2. Promethease.
  3. genesis.gedmatch.com.
  4. Codegen.
  5. Genomelink.
  6. Sequencing.

В «Атласе», помимо классического ДНК-теста, я сделал еще ДНК-микробиоты. Если будет интересно — напишите, сделаю по нему отдельный материал.

Как происходит сдача биоматериала

Вам присылают специальный сосуд, вы туда сплевываете слюну до деления, заливаете консервирующим раствором из комплекта и отправляете обратно. В случае MyHeritage там не сосуд со слюной, а соскоб с внутренней поверхности щек. Все это самостоятельно, по простой инструкции.

Какие есть нюансы по доставке:

  • 23andMe. Самый сложный тест, так как он не отправляется в Россию в принципе. Пришлось заказывать через посредника, который еще не забанен компанией. Также нельзя из России отправлять обратно. Поэтому пришлось попросить знакомых, которые летели в Амстердам, чтобы они бросили коробку с биоматериалом в местный почтовый ящик. Если же вы отправите из России, 23andMe может аннулировать ваш аккаунт. Я читал о таких случаях, поэтому решил не рисковать.
  • MyHeritage. Отправляют в Россию без проблем. И даже бесплатная доставка от двух комплектов. Но отправить обратно придется за свой счет. Лайфхак: обычной «Почтой России» дошло за неделю до Хьюстона (где находится лаборатория MyHeritage). А вот EMS-отправление шло три недели. И это при разнице в цене в 20 раз не в пользу EMS!
  • «Атлас» и Genotek. Никаких проблем и долгих ожиданий. Привозит и забирает курьер. Хотя я в «Генотек» заехал лично, у них в специальном кабинете с женой наплевали, чтобы не ждать курьеров. Но эти тесты и самые дорогие.

Итак, к результатам. Давайте начнем с происхождения.

Вводные: сам я русский, родился на Дальнем Востоке, мои мама и папа тоже с Дальнего Востока. По одной линии дед и бабушка с Краснодарского края, по другой — из Сибири и Алтайского края. Все русские.

Происхождение в тесте MyHeritage

Здесь вообще территория России почти не используется. Но даже абстрагируясь от непонятного расположения ареалов восточно-европейцев, почему прибалтов у меня 33%, непонятно. Прибалтов точно в роду не было. У жены тоже прибалты. Хотя она и ее родственники совсем из других регионов. Видимо, особенности работы алгоритмов MyHeritage.

Еще MyHeritage — единственный сервис, который увидел во мне немного еврея (1,5%). Но это особенность именно этого сервиса, он родом из Израиля и многим завышает показатель по ашкенази.

В тесте не содержится сведений о гаплогруппах.

По итогу в MyHeritage — очень странное и бестолковое происхождение. Пустая трата денег. Из полезного только сырые данные, которые можно потом интерпретировать.

Количество найденных родственников — 3241 человек. Из России — 89.

Происхождение в тесте 23andMe

А здесь уже что-то похожее на правду. 86,5%, что восточно-европеец. Вот сильно похоже. Остальные цифры ничего не значат. Все показатели ниже 5% обычно воспринимаются как шум и не учитываются.

То есть здесь 23andMe «угадал». Но сделать это было несложно, учитывая, что сервис попросил меня заполнить анкету перед выдачей результатов. Там был вопрос о происхождении, я решил не врать и честно написал, что из России.

Но здесь можно кликнуть на блок восточно-европейцев и получить расклад по регионам.

А вот это уже интереснее. Здесь подсвечены регионы, в которых жили мои предки. Это настолько похоже на правду, что даже пугает.

Гаплогруппа по отцовской линии R-L260 (R1a1a1b1a1a) и по материнской линии H6a1a.

Есть просмотр древних предков по каждой из материнской И отцовской гаплогрупп.

Количество найденных родственников — 1248. Из России — 36.

Происхождение в тесте Genotek

Здесь нет карты. И нет процентов какой-то нации. Здесь просто вероятности, кем я могу быть.

С точки зрения Genotek я могу быть с одинаковой вероятностью литовцем, белорусом, поляком, украинцем, шведом, русским, эстонцем, хорватом и молдаванином. В общем, точность прогноза самая низкая из всех тестируемых вариантов. Честно говоря, еще один бестолковый тест. Особенно учитывая, что у меня и у жены результаты одинаковые.

Гаплогруппа по отцовской линии R1a1a1b и по материнской линии H6a1a.

В Genotek есть карта пути следования моих гаплогрупп по отцовской и материнской линиям.

Количество найденных родственников — 14. Все из России.

Происхождение в тесте «Атласа»

Тут красивая карта ареалов. Вроде бы, тест российской компании, но ареал обитания русских только в западной части страны. За Уралом, видимо, русские не живут, по мнению «Атласа».

Еще непонятно соотношение. Чехов с венграми во мне больше, чем русского. Ну, странная тема.

Гаплогруппа по отцовской линии R1a1a1 и по материнской линии H6a1a4.

Здесь есть очень красивая карта отцовской и материнских линий гаплогрупп. Но почему-то не до конца провели их

Родственников не ищет (или я не нашел где).

Происхождение в тесте FamilyTreeDNA

На этот тест я уже не сдавал слюну, а загрузил сырые данные и оплатил интерпретацию.

Удивительное рядом. Граница Восточной Европы проходит четко по границам России. Огромный процент Южной Европы не соответствует моим наблюдениям и другим тестам. Точность теста низкая. Здесь есть серое облако на Дальнем Востоке — это 3%, что обычно считается погрешностью и не учитывается в результатах.

Количество найденных родственников — 933. По месту сортировки нет.

Происхождение в GEDmatch

Здесь нет красивой карты. Да и результаты будут меняться в зависимости от алгоритма, который используем. Я час гонял разные алгоритмы и нашел параметры, по которым происхождение было похоже на мое. Но считаю некорректным подгон результатов. Поэтому выкладываю стандартный распространенный алгоритм.

По нему я наиболее близок к молдаванину, затем к немцу, хорвату, словаку, украинцу и другим. В общем, мимо.

Из плюсов: GEDmatch — единственный бесплатный тест в подборке по происхождению.

Количество найденных родственников — более 3000 (отображаемый максимум). По месту сортировки нет.

Выводы по происхождению

По разбросу результатов понятно, что еще есть куда расти алгоритмам. С чем справились все тесты — поняли, что я как-то связан с Восточной Европой. Причем в некоторых тестах моя страна не входит в Восточную Европу.

До обновления 23andMe я вообще решил, что все это происхождение по ДНК — гадание на кофейной гуще. Но после обновления 23andMe он стал единственным тестом, который выдал результаты, близкие к реальным. Также это единственный тест, показывающий разбивку по регионам России (с неплохой точностью).

Можно было бы все свести к неточности алгортимов. Но что меня удивило — в разных тестах немного различаются мои гаплогруппы.

Например, в 23andMe самая длинная по мужской линии, а в «Атласе» — по женской. Еще раз, я не являюсь генетиком. Но что-то мне подсказывает, что может такой разброс в точности определения происхождения связан не только с плохими алгоритмами, но и разницей в вводных данных, которые получаются после секвенирования моего ДНК.

Здоровье

Это, на мой взгляд, самая интересная часть. Гораздо более изученная учеными и точная. Почти все крупные тесты ссылаются на фундаментальные работы при выдаче результатов. Также здесь больше сервисов на рынке, есть что посмотреть.

Здоровье в тесте 23andMe

После результатов происхождения ожидаешь здесь чего-то очень подробного. Но по факту тест нашел у меня предрасположенность к одному заболеванию. И все. Больше никакой информации. Еще есть 45 пунктов Wellness и Traits, которые больше как забавные факты, чем реально полезные вещи.

Как видно из скриншота, 23andMe сообщил, что я «скорее всего, могу почувствовать запах съеденной спаржи в моче» или у меня «скорее всего, мокрая сера в ушах». Что мне делать с этой информацией и главное — зачем мне это знать? Чего-то действительно полезного здесь нет. Вывод — 23andMe лучший в плане происхождения, но совершенно не подходит для определения рисков здоровья.

Здоровье в тесте Genotek

Genotek выдал мне список из 17 рисков с процентной вероятностью ими заболеть у меня и в среднем по популяции людей вокруг меня. Причем в расчетах учитывается возраст, и риски меняются со временем. То есть они сделали что-то вроде превентивного планировщика заболеваний.

Наглядность меня удивила, но еще больше — объем информации. По клику на каждый мой риск есть подробное описание. Вот пример одного из рисков.

При соблюдении правильного образа жизни я снижаю риск по заболеванию до среднего по популяции.

Есть и информация для врача. По клику на любой из этих генов я попадаю на экран с исследованиями и доказательствами, откуда это взято. Этим разделом уже пользовался мой лечащий эндокринолог.

Помимо раздела со здоровьем, есть раздел «Диета и фитнес», где указаны спортивные предрасположенности, риск травм, предрасположенность по гормонам и нехватке конкретных витаминов и микроэлементов.

Я решил протестировать эти витамины в лаборатории, и действительно, витамина D было очень мало, гомоцистеин и кальций чуть выше верхней границы нормы. После чего добавил в рацион витамин В и привел значение в норму за счет лошадиных доз каждый день в течение нескольких месяцев.

Также тест от Genotek рассчитывает диету и план тренировок в зависимости от цели, но именно к этой функции я отношусь несерьезно. Поэтому пропустим.

Но что интересно, есть уникальная вещь, эффективность лекарств, где собрано огромное количество лекарств и моя личная реакция на них. Вот пример из списка:

Еще здесь есть сервис прогнозирования рисков серьезных заболеваний у детей. Нужно два теста в одном аккаунте иметь, тогда сервис выдаст, какие наследственные заболевания могут возникнуть и с какой вероятностью. У нас с супругой, слава богу, таких не было.

Отчет Genotek самый объемный из всех сервисов, что я видел, очень наглядный и привязанный к реальности.

Здоровье в тесте «Атлас»

Здесь есть, также как и у Genotek, информация о каждом риске.

Что интересно: по здоровью в «Атласе» есть риски, которых нет в Genotek (и тем более в других тестах). Но и в Genotek есть риски, которых нет в «Атласе». Общий объем не такой большой.

Здесь просто набор забавных фактов, ничем не примечательный сервис, который стоит $14 в месяц. За эти $14 они добавляют несколько фактов ежемесячно.

Я был полгода подписан, вспоминал каждый раз после списания, думал, что надо отписаться, и забывал. Практического применения этого сервиса немного, так как заболеваний здесь нет.

Здоровье в Promethese

Этот сервис был первым, куда я загрузил сырой файл из первого своего теста в MyHeritage. И чуть не поседел. Судя по выдаче этого сайта, умирать я буду в муках и от всех возможных болезней. Там сотни разных рисков, читать все это страшно.

Хотя с тех пор прошло больше полугода и выдачу они сократили. Да, еще это бесплатный сервис. Но лично я решил им не пользоваться. Информация плохо структурирована. Исследования, которые влияют на один и тот же риск, разбросаны по тексту, надо вручную выискивать и сопоставлять. Проще воспользоваться сервисами, где это делается автоматически.

Здоровье в Codegen

Очень много разбросанных рисков, взятых из непроверенных источников. Я когда читал, расстраивался с каждой строчкой. Столько негативных предрасположенностей я от себя не ожидал. А потом оказалось, что информация на этом ресурсе не проверена серьезными исследованиями. Поэтому я расслабился и больше на этот сервис не хожу.

Здоровье в Sequencing

Сайт-магазин. Загружаете сюда из любого источника сырые данные, покупаете здесь приложения, которые их расшифровывают. К этому моменту я не стал покупать платные, так как и так стало страшно, сколько денег потратил на изыскания по ДНК. Поэтому посмотрел только бесплатные модули. Ничего примечательного не нашел. То, что видел, — упрощенная копия 23andMe

Выводы по здоровью

Лично мне больше всего понравился тест от Genotek. Он самый объемный, с визуализацией и привязкой к текущей ситуации. Я проверил риски, и они совпали с лабораторной диагностикой. В плане теста здоровья, на мой взгляд, это лучшее из всего, что я пробовал. Как на русском языке, так и на английском.

Хочу отметить тест «Атласа», поставив его на второе место. У него меньшая информативность, но тоже есть расчет рисков исходя из текущей ситуации по анкете.

Остальные популярные тесты, на мой взгляд, больше для развлечения. И меньше подходят для того, чтобы понять риски и скорректировать образ жизни.

Стоимость тестов

Вот важный момент — стоимость. Цены я указал на 4 ноября (в момент обновления статьи). Сейчас идут распродажи во всех сервисах по ДНК. Видимо, в честь Хэллоуина. Позже цены могут измениться.

Myheritage и FTDNA самые доступные тесты. В виду плохого выполнения основной задачи – показа происхождения годятся они только для недорого получения сырых данных, которые можно потом интерпретировать в других местах. В какой из этих лабораторий заказывать – без разницы, тк Myheritage своей лаборатории не имеет и делает на мощностях FTDNA.

Важный момент – при заказе этих тестов – сырые данные в 23andme загрузить будет нельзя. Скачать из 23andme можно, а загрузить в него только из теста Ancietry, который я не покупал, так как он заточен под внутренний рынок США.

На мой взгляд, бесмысленно покупать тесты этих двух компаний если вы не преследуете поиск родственников. В них много найдено моих родственников, но толку ноль: родственные связи на уровне четырех-пяти поколений, то есть общей пра-пра-прадедушек и бабушек или больше.

Единственное использование, которое вижу, — получить недорого сырой файл от этих сервисов и крутить до посинения в бесплатных сервисах. Но лично мне они быстро надоели ввиду плохого интерфейса и сложности извлечения информации.

Если есть желание максимально сэкономить и получить наиболее точные результаты происхождения и здоровья, я бы сделал тест в 23andme, получил оттуда сырые данные и интерпретировал их в Genotek. «Атлас», к сожалению, не позволяет загружать сырые данные, как и 23andme.

Также в 23andme нет смысла брать с интерпритацией здоровья: от нее толку все равно нет. Сырой файл будет все равно один и тот же. Получается сэкономить еще $20 по цене распродажи.

Если нужно только происхождение , можно сделать в 23andme и больше не париться, на сегодня я ничего близко к этому не видел.

Если нужно только здоровье и есть возможность, лучше сделать «Атлас» или Genotek. И там, и там, кстати, есть консультация генетика, которая сама по себе стоит недешево. Лично я и обе бесплатные консультации взял к этим тестам, и дополнительную позже в Genotek, и еще консультацию эндокринолога в клинике «Атласа».

Консультации все равно скорее всего понадобятся, здесь хотя бы по одной входит бесплатно. Хотя они больше обзорные и неглубокие. Не стоит на них расчитывать на решение какой-либо проблемы.

Заключение

Сейчас я советую друзьям, когда они спрашивают. что для понимания происхождения лучший на сегодня 23andMe. Благодаря самой большой точности попадания, да еще и с разбивкой по регионам.

Для понимания здоровья лучший Genotek. Это фантастический объем рекомендаций, удобный интерфейс, индивидуальные расчеты в зависимости от возраста и PDF-отчет на 150 страниц рекомендаций по итогам теста.

Есть еще отдельная история с ДНК микробиоты. Тут единственный игрок – «Атлас». Но микробиота не тема сегодняшней статьи. Поэтому ее я не упоминал. Также у «Атласа» довольно неплохая клиника. Имеет смысл сделать там ДНК-тест, если планируете там лечиться.

Вот кроме этих трех компаний, лично для меня, смысла никуда смотреть нет. Разве что на Dantelabs, где можно недорого (относительно) сделать полное секвенирование всего генома, а не только 600–700 тысяч снипов как у всех перечисленных лабораторий выше.

Также важный момент — в тесты от «Атлас» и Genotek входит бесплатная онлайн-консультация генетика по результатам теста. Это приятное дополнение, воспользовался и там, и там. И эта консультация еще больше прояснила направление движения и дальнейшего контроля за здоровьем.

Дисклеймер: я не являюсь генетиком, ученым или врачом. Я простой пользователь, который решил больше узнать о себе и этим поделиться. Прошу извинить за непрофессиональный язык и возможные ошибки.

Материал опубликован пользователем.
Нажмите кнопку «Написать», чтобы поделиться мнением или рассказать о своём проекте.

Написать

Источник: https://vc.ru/life/90971-dnk-test-v-desyati-raznyh-kompaniyah-na-primere-moego-sobstvennogo

ДНК-тесты на происхождение и с чем их едят (часть I)

Как определить свой гаплотип и гаплогруппу

ДНК-тесты на происхождение и с чем их едят.

Привет, читатель!

Сейчас генетические тесты становятся все популярнее. Но что за ними стоит: точная наука или гадание на кофейной гуще? В этой статье мы с вами разберемся на примере тестов на происхождение. А все непонятные термины мы объясним.

Кем были мои предки?

Как они жили?

Были ли в моем роду представители других народов?

К какому народу я отношусь?

Мои однофамильцы, кто они мне?

Все эти вопросы задавали Вы себе хотя бы раз. Знание своей родословной является неотъемлемой частью человеческой культуры, вне зависимости места проживания, социального положения или этнической принадлежности.

Свои родословные составляют и английские дворяне, и обычные жители далекого бурятского села (еще кстати вопрос у кого родословная глубже), кинозвезды и школьники.

Ведь идентификация себя и своих предков, это как некий ориентир в современном глобалистком мире.

Но как мы можем искать ответы на эти вопросы? Инструментов не много:

-Семейные легенды. Как правило они серьезно искажают реальное положение дел. И очень часто люди ассоциируют себя только с той или иной родословной линией, никто не хочет быть потом крепостных, но все хотят быть потомками дворян,купцов и казаков.

-Архивные данные. Главный вопрос в доступе к документам их сохранности, умении читать старинный шрифт, глубине доступной информации.

-Краеведческая литература. Она, увы, принципиально не может охватывать всех проживающих на территории но в отдельных случаях сила энтузиастов может быть полезна.

-Антропология. Некоторые черты Вашей внешности могут указать на наличие предков из тех или иных народов, но данный подход не актуален с научной точки зрения (подробнее об этом напишем в следующей статье), однако иногда работает.

-ДНК-генеалогия. Относительно новый метод. Успех зачастую зависит от прогрессирующего количества тестируемых в разных базах данных ( мы располагаем пожалуй одной из самых крупных в России), что повышает шансы на положительный результат. Один только тест на ДНК, может установить родство как отдельных лиц, так и целых групп (например однофамильцев).

В своей работе наша компания опирается на две базы данных, одна собрана из популяций по всем правилам научного отбора респондентов (моноэтничность в трех поколениях, не родственники и т.д.

) и коммерческую базу которые собрали энтузиасты (они сами структурируют информацию по ним, тестируют своих родных, уточняют им ветви гаплогрупп, создают свои фамильные проекты и т.д.)

И сегодня мы поговорим о ДНК тестах как инструменте в изучении своей родословной. Заодно узнаем насколько % вы относитесь к этносу который считаете своим :))

ТОП-10 вопросов которые Вы уже приготовились задать нам, но мы уже подготовили на них ответы 🙂

1.Этническое самосознание и гены

2.Принцип наследования Y-хромосомы

3.Принцип наследования мито-гаплогруппы

4.Я получил результаты.Что дальше?

5.У меня гаплогруппа R1a1,это значит я настоящий славянин?

6.У меня гаплогруппа Q/E/G/J/T/О/ etc. это значит что я не принадлежу к тому этносу с которым себя ассоциировал?

7.Если у нас совпадает полностью весь гаплотип с “генетическим собратом” , значит ли что мы родственники?

8. Если у моих родственников и у меня разные гаплогруппы, может ли это быть ошибкой теста?

9. Как быть, если по итогам теста нет генетических кузенов?

10.Чем отличается аутосомный тест и тест на Y-гаплогруппу

Сначала о терминах:

Геном человека – набор молекул ДНК. Изначально можно разделить на две группы: ядерная ДНК и митохондриальная ДНК. Ядерная, как вы уже догадались, находится в ядре, а митохондриальная в митохондриях, которые плавают в цитоплазме клетки.

Хромосома – единичная молекула ДНК.

Ядерная ДНК – представляет из себя 23 пары хромосом, одна из которых половая и будет сильно отличатся от пола организма, а остальные 22 пары называются аутосомными.

Y-хромосома – одна из двух половых хромосом в системе хромосомного определения пола XY, которая встречается у многих животных, большинства млекопитающих, в том числе человека. Присутствует только у мужчины! Длина Y-хромосомы около 50 млн нуклеотидов.

Гаплотип – группа участков ДНК, наследуемых вместе.

Y-гаплогруппа – группа схожих гаплотипов Y-хромосомы, имеющих общую мутацию, унаследованную от общего предка. Передается вместе с Y-хромосомой – строго по мужской

мтДНК– или митохондриальная ДНК. Содержится в цитоплазме клетки. При оплодотворении содержится только в яйцеклетке, а следовательно передается только от матери всем детям. Из-за маленькой длины – 16 тысяч нуклеотидов, и большой количества генов, мутации в ней возникают очень редко.

Аутосомные хромосомы (аутосомы) – 22 парные хромосомы. Каждая пара примерно одинаковой длины и содержит одинаковые гены. По наследству детям передается по одной из каждой пары от каждого родителя.

Из-за непрерывной рекомбинации (обмен одинаковых участков между парными хромосомами), каждая из 22х хромосом, доставшихся нам от мамы, перемешивается с 22мя, доставшихся от папы. Поэтому если ученый выделяет из клетки одну аутосомную хромосому, то он не может точно сказать от кого из родителей она пришла.

Своему ребенку вы передаете такие же перемешанные хромосомы, в которых будут примерно в равных пропорциях части генома ваших родителей. Таким образом человек наследует наборы мутаций от всех своих предков.

Поколение– обычно за поколение считают шаг в 20-25 лет. Таким образом 100 лет= 4 или 5 поколений, но т.к. кто то рождается , а кто то достигает совершеннолетия в самом начале века то около 6 поколений.

1. Этническое самосознание и гены.

Вопрос в большей степени лежит в плоскости этнографии,этнопсихологии и самосознания. В своих экспедициях при анкетировании респондентов мы всегда записывали ту этническую группу которую озвучивал сам опрашиваемый, какой бы она иной раз фантастической не была.

Однако при этом надо понимать два главный тезиса : а)Ваши предки могли влиться из одного этноса в другой, б) с точки зрения генетики Вы сборная солянка всех ваших предков, а не только того кто передал Вам свою Y или Mt гаплогруппу (см. ниже разницу в аутосомном тесте и теста по однородительским линиям).

Таким образом Вы тот, кем себя ощущаете, и на языке какого народа думаете. Более того есть даже примеры (ирландцы например) когда народ теряет язык, но не теряет идентификацию.

А.С. Пушкин многие помнят о его предке арапе Петра Великого, но о том , что по остальным линиям он русский дворянин не помнят 🙂

Что же изучает генетика?

Наша ДНК состоит из последовательности 4 нуклеотидов – молекул аденина, тимина, гуанина и цитозина, для простоты ученые их обозначают буквами A, T, G и C.

Основная задача генетики состоит в том, чтобы “прочитать” (секвенировать) последовательность ДНК – определить порядок в каком расположены нуклеотиды. После “прочтения” получается последовательность длиной около 3 млрд букв.

Далее генетики сравнивают эту последовательность с референсным геномом (усредненный геном, составленный из геномов нескольких человек) и изучают отличия – мутации.

1.1 Как часто мы мутируем?

Мутации в ДНК у нас происходят постоянно.

Это происходит под влиянием ультрафиолета, природной радиации, свободных радикалов (вредные химические соединения которые встречаются как в парах бензина, так и в жареной картошке), а также при делении клетки, система копирующая ДНК допускает ошибки.

Но система восстановления (репарации) умеет находить большинство таких мутации и восстанавливать исходный вид ДНК. Но что случается, если система репарации не находит мутацию? Это зависит от типа мутации и её положения в геноме.

Не вдаваясь в подробности, можно поделить весь геном на экзом и все остальное. Экзом – это как раз те самые инструкции, читая которые, клетка синтезирует белки. Поэтому мутация в экзоме может привести к мутации в белке, что может вызвать серьезную болезнь, например рак.

Но мутации могут и улучшить нашу жизнь – как например те, что возникли в гене MCM6, позволяют большинству взрослых европейцев пить молоко. Система репарации особо чутко следит именно за экзомом и старается исправлять в нем все ошибки. Экзом составляет всего около 1% от всей молекулы ДНК.

В остальной части ДНК безусловно есть важные элементы, но их длина на порядки меньше экзома, поэтому дальше мы про них забываем.

Теперь можем говорить, что мутации вне экзома ни к чему не приводят, а поэтому системе репарации не так важно чутко наблюдать за остальной частью, и мутации там возникают намного чаще.

Мутации бывают: в конкретной позиции ДНК (в таком случае её называют снипом/SNP/однонуклеотидный полиморфизм), удаление или вставка участка днк (тогда их называют делециями или инсерциями соответственно).

В ДНК встречаются участки, называемые тандемные повторы – когда одна и та же последовательность повторяется несколько раз.

Система копирования ДНК сложно работать на таких участках, поэтому она частенько сбивается и количество таких повторов может увеличиваться или уменьшаться.

Также важно отметить, что мутации о которых будем говорить дольше, должны закрепиться в популяции. Так, если солнечный свет попал на кожу и произошла мутация в клетке кожи, то она никогда не передастся детям.

Чтобы эта мутация закрепилась, она должна возникнуть в половой клетке, где система репарации работает особенно бдительно, и только тогда сформированный из нее организм в каждой клетке будет содержать эту мутацию. Например изменение длины на один повтор 18 STR-локусов (участки, содержащие тандемные повторы) происходит в среднем раз в 300 лет.

Поэтому если у двух человек отличается один из 18 STR- локусов на единицу, то вероятнее всего, их общий предок жил около 300 лет назад.

2. Принцип наследования Y хромосомы.

Мужская хромосома как я писал выше передается строго по отцовской линии от отца к сыну. В какой то момент в том или ином участке могут появляться мутации. .Более подробно мы расскажем об этом во второй части статьи на реальном примере двух однофамильцев.

3. Принцип наследования mt-ДНК.

Женская линия передается всем детям от носительницы таковой. Она конечно менее информативна чем Y гаплогруппа по ряду причин, но однако может таить в себе сюрпризы.Например у автора строк дедушка по материнской линии, который корнями из Приазовья, носитель мтДНК линии Y1 (не путать с Y-гаплогруппой), которая характерна для коряков, нивхов, корейцев и некоторых тюркских народов.

4. Я получил результаты теста. Что дальше?

Отлично. Остальное зависит от ваших целей и задач. Скорее всего Вы узнаете свою “корневую” (еще ее называют “кОровой” гаплогруппой) гаплогруппу. Она будет являться родительской по отношению ко всей своей ветви, и ближайшие совпаденцы к Вам будут в пределах от 500 12000 лет.

Опираясь на данные теста можно его расширить уточнив ветвь Вашей гаплогруппы или же получить услуги наших генеалогов которые смогут на основании полученной информации построить Ваше родословное древо (если ближайшие совпаденцы будут в пределах наличия бумажных источников).

Которое может привести к сюрпризам 🙂

Продолжение следует…

Источник: https://pikabu.ru/story/dnktestyi_na_proiskhozhdenie_i_s_chem_ikh_edyat_chast_i_6058203

Анализ на гаплогруппу: как узнать по ДНК тесту на генеалогию

Как определить свой гаплотип и гаплогруппу

› Обязанности

20.01.2020

Сейчас все большую популярность приобретает анализ на гаплогруппу, результаты которого позволяют установить историю происхождения и миграции рода, самых дальних прародителей. В современной генетике гаплогруппы имеют буквенные обозначения от А – самой древней, которая сформировалась 200 тысяч лет назад, до R – самой молодой, возраст которой составляет 25 тысяч лет.

На сегодняшний день практически нет людей, которые бы 100% принадлежали к одной группе. Как правило, присутствует смешение нескольких народностей. В качестве примера можно привести следующие характеристики генетических групп:

  • Т – появилась в Западной Азии примерно 20 – 30 тысяч лет назад. Среди современных носителей – жители Ирака, Египта, Омана, Сомали. В Европе ее представителей больше всего среди сербов – до 7,0%. В юго-западной части России она встречается примерно у 1,67% населения и отсутствует у жителей североевропейских регионов.
  • N – распространена в Европе, а также в европейской и азиатской части России. Самые «чистые» с точки зрения генетики представители – ненцы, якуты, удмурты.
  • О – появилась 30 – 40 тысяч лет назад в Восточной Азии, ее основные представители относятся к монголоидной расе. Встречается у 21% всего населения планеты. Типичные представители – китайцы, японцы. Полностью отсутствует на европейском континенте, Ближнем Востоке, в Африке и Америке.

https://www..com/watch?v=ytabout

Точное соотношение каждой группы можно узнать, если сдать анализ на гаплогруппу в специализированной лаборатории.

Если Вы хотите пройти анализ ДНК на генеалогию гаплогруппы, обращайтесь в ДНК лабораторию ДТЛ, которая является лидером в области генетических исследований. Здесь применяются передовые технологии ДНК-исследований, используется современное оборудование «Applied Biosystems», которое признано самым эффективным в мире.

Мы стремимся сделать наши услуги удобными и доступными для всех желающих. Поэтому сдать образцы биоматериала – клеток буккального эпителия, можно как у нас в лаборатории, так и дома, с использованием специального бесплатного набора. Как его получить и правильно сделать соскоб, расскажут наши консультанты.

Основными преимуществами наших услуг является:

  • объективность и высокая точность результата – в пределах 100,0%, ошибки и неточности полностью исключены;
  • высокая скорость проведения анализа за счет применения высокотехнологичного оборудования и выполнения всех операций без привлечения сторонних компаний;
  • ценовая доступность услуг, регулярные скидки;
  • бесплатная консультационная помощь.

Заказать определение гаплогруппы в Москве можно на нашем сайте. Более детальную информацию можно получить у наших консультантов в телефонном режиме.

Как узнать свою гаплогруппу

Чтобы определить, к какой этнической или расовой группе принадлежит человек, необходимо сдать анализ крови на гаплогруппу или образец буккального эпителия, после чего проводят лабораторное исследование биоматериала. В гаплотипе исследуемого человека выделяют специальные маркеры, по которым и проводится сопоставление.

Сейчас определение гаплогруппы по ДНК проводится следующими способами:

  • по Y хромосоме;
  • по митохондриальной ДНК.

Для мужского пола исследования проводятся по мтДНК и Y хромосоме, для женского – по митохондриальной ДНК. Самый распространенный способ проведения исследований предполагает использование гаплотипа с 25 маркерами.

Поскольку за длительное время генотип человека претерпел различные мутации, на сегодняшний день стали использовать большее количество маркеров, число которых может достигать 111.

Чем большее количество маркеров используется в процессе исследования, тем более точный результат можно получить.

Как проходит анализ ДНК на гаплогруппу

Чтобы сделать генетический анализ гаплогруппы, следует обратиться в лабораторию, которая специализируется на проведении ДНК исследований. Процедура проходит следующим образом:

  • Берется образец молекул ДНК – путем соскоба на внутренней поверхности щеки.
  • В лабораторных условиях проводится анализ путем прямого секвенирования. Образцы исследуемого лица сравниваются с базой данных, определяется сходство.
  • Полученная информация интерпретируется с применением методов этногеномики.

https://www..com/watch?v=ytpress

После того, как проведен анализ на гаплогруппу, составляется официальное заключение, которое оформляется на фирменном бланке. В нем указывается процентное соотношение каждой группы, указываются миграционные направления дальних предков, происхождение гаплогруппы, какие племена и народы жили на этих землях, а также кто из известных людей имеет такую же гаплогруппу.

Анализ на гаплогруппу: как узнать по ДНК тесту на генеалогию Ссылка на основную публикацию

Источник: https://translev.ru/gde-sdat-dnk-markery/

Book for ucheba
Добавить комментарий